Lizzo meme

Download the iPhone App!

Get over 50 fonts, text formatting, optional watermarks and NO adverts!

Get your free account now!

Meme Generator

I just took a mRNA test, turns out, I'm 100% - ACCUGUCAAGCGUGAGACGG

Check out all our blank memes

add your own captions to a 'Lizzo' blank meme
report this image

Report this image

Reason is required.
You must enter the numbers you see.

Get over 50+ fonts, text formatting, optional watermarks and NO adverts!

Get your free account now!